Notes from lab 2/18/10

*DNA Fingerprinting
Use of DNA to identify individuals
• DNA: sequence of bases held together by a sugar-phosphate background
o Sugar-Phosphate: ATCGGATCATAAATCATCAGAC
• Individuals vary with respect to sequence of bases in DNA
• Restriction enzymes - is an enzyme that cuts double-stranded or single stranded DNA at specific recognition nucleotide sequences known as restriction sites.
o Break sugar- phosphate backbone of DNA at particular sequence of bases (different sequence for different restriction enzymes)
o WHY? – defense against viruses
o Where from? – Bacteria
 Restriction endonucleases
• So individuals also vary with respect to location and number of restriction sites for particular restriction enzyme

*Today 2/11/10 :
o Set up tubes containing DNA samples + restriction enzymes
o Label tubes
o Blue = Suspect 1
o Orange = Suspect 2
o Purple = Suspect 3
o Pink = Suspect 4
o Yellow = Suspect 5
o Green = Crime Scene
o Place 10 micro liters of restriction enzyme solution in each tube
o Place 10 micro liters of each DNA sample into appropriately labeled tubes
( CHANGE PIPET TIPS)
• Restriction Sites :
o Eco R1: 5’G*AATTC3’
3’C TTAA*G5’
3’ – “three-prime”
5’ – “five-prime”

o Pst 1 :
• Chemists label carbons in sugars
o Ex. Deoxyribose
 5-carbon sugar
 Pentagon with Carbons at each corner
 Phosphate – Phosphorous attached to 4 Oxygens

 Make 1% weight/volume agarose in 1x Tris-Acetate-EDTA buffer and microwave to boiling about 2 minutes
 1x = working concentration
 5x = concentrated 5x more than needed
 Chromatin picks up the color
 Histones are positively charged, which is why DNA wraps around them
 Add 5 microliters of loading buffer (LB) to each DNA sample
 Put 25 microliters of samples into separate wells
 Put 15 microliters marker into 1 well
 Attach to power supply run electrophoresis for 30 min at 200 V
 Soak in 0.01% Ethidium Bromide in 1x TAE buffer
 Ehidium bromide: slips between bases in DNA
 Fluoresces bright pink with UV light
Chapter 11
Molecule of Inheritance : Chemical that is cell instructions
 Protein
 Mainly what organisms made of
 Proteins made of amino acids (20 of them)
 Proteins very common
 Heat changes permanently
 DNA
 Not what organisms mainly made of
 Nucleotides and sugar phosphate
 Only four Nucleotides
 Not very complex
 Ha: Protein is the molecule of inheritance
 Ho: Protein is not the molecule of inheritance.
 Can be heated and cooled, doesn’t change

Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License